Ideal Tm
This program finds a PCR primer pair with no hairpins, or self annealing properties close to a given temperature. (To find multiple primer pairs at once try MultiPrimeMate.)
The basic input format is
outside-sequence(inside-sequence...inside-sequence)outside-sequence
Example input would be:
gagagctcaaccaccaaaggacatcgaaaag(gc...ag)gtagctggggaaattggaatcaaacaagaagagct TGG AGA AAG ACT TTC GCC AAT AG(G GTA AG)C ATG TGA TCA GCG AAC GTC acagtgctcaacgtcggatccggaaaac()aagatcaagtcacttttactgttgccgactctttgcctgttgtcta
You can include as much or as little of the inside sequence as you want. The program doesn't look at anything inside the parenthesis. The input can span multiple lines.